Sentence examples for were created utilising from inspiring English sources

Plasmids were created utilising standard DNA cloning methods.

pLIC-MGN was created by utilising the same NdeI-BamHI sites, but incorporating a cassette of the following oligonucleotides: 5'-tatgcaccatcaccatcaccatggaactagtgaaaacctgtatttccagggag cagccgcggccggtgctttgcag-3' and 3'-acgtggtagtggtagtggtaccttgatcacttttggacataaagg tccctcgtcggcgccggccacgaaacgtcctag-3'.

We're getting the chance to utilise moulds that were created specifically for the show and translate them into parts of the attraction.

Be a Man campaign activities and social media posts utilised materials that were created specifically for the programme by a creative team comprised of professionals and youth from the region (see Figure 1).

Such a look-up table is created offline by utilising computational fluid dynamic (CFD) modelling techniques.

Thousands of high-skilled engineering jobs could be created in Lancashire by utilising shale gas resources, said the Institution of Mechanical Engineers.

The system was created using Visual Basic programming and utilised existing word processing and database software.

The plethora of internal signalling required for gene expression is created by the cells by cleverly utilising a comparatively limited reservoir of molecules.

Once a unique product fitting these criteria was found (smoked hummus) and the market tested, the business was created using very careful bootstrapping, utilising services offered by larger organisations (such as consultation with a solicitor through the business bank account) and working with people on a "need to hire" basis.

Humans are aerobic organisms and when oxygen is utilised in metabolic processes, free oxygen radicals are created as a consequence.

While many clubs utilise stability and team spirit to survive relegation, Watford are creating a model of their own, and it's breath-taking to watch.