Sentence examples for were as reported from inspiring English sources

The details of the arrangement were as reported by The Wall Street Journal in its original article.

Gas chromatographic conditions were as reported above; transfer line temperature, 295°C.

Detailed structural information was obtained by RSXS measurements and it was confirmed that the structures of the Pt layers were as reported.

The symptom descriptions and rankings (as summarized in Tables 2 and 3) are described using the specific item descriptions provided in the original assessment scale and the frequency or severity data were as reported by the original researchers.

While environmental campaigners were, as reported in 2001, pleased about the plan's positive effects, they attempted to force the US government to do more.

Other details were as reported above.

DNA FISH conditions were as reported by CAMBIO instructions.

αSMA, TGFβ1 and TGFβ2 primers were as reported [11], TNFα, IL6 and inducible NO synthase (iNOS) primers were as described [17], tenascin-C primers were as reported [24].

Primer sequences were as reported previously [12] except MIF with forward GCCAGAGGGGTTTCTGTCG, and reverse GTTCGTGCCGCTAAAAGTCA sequences.

Conditions for the induction of calcium accumulation were as reported previously [18].

Oocyst excystation, fluorescent dye labelling and flow cytometric parameters were as reported therein.