Your English writing platform
Discover LudwigExact(1)
The primer sequences were as listed below: 11, 25 ERG Forward: 5′- ACCGTTGGGATGAACTACGGCA-3′ Reverse: 5′- TGGAGATGTGAGAGAAGGATGTCG TMPRSS2-ERG Forward: 5′- AGCGCGGCAGGTTATTCCA-3′ Reverse: 5′- ATCATGTCCTTCAGTAAGCCA-3′.
Similar(59)
Our findings are as listed below: (1) Carbon dioxide diffusion coefficient depends on thickness of the finishing material based on accelerated carbonation experiment result.
The undesirable consequences of unintentional islanding are as listed below which illustrates the need of unintentional ID for effective integration of DGs into existing power system topology [8, 9]: Distributed generations are typically "weak" supplies that are incapable to handle transients efficiently.
Within each target district, the CHMT members who participated in the study are as listed below.
Number of key observations highlighting the role of MR in evaluation of renal masses is as listed below: - There is some controversy regarding the role of signal loss on opposed phase chemical shift imaging in discriminating AML from RCC [ 3, 4].
The secondary outcomes as listed below are; The craving level, as indexed by self-report using the Desire for Drugs Questionnaire (DDQ) and a visual analogue scale (VAS).
To maximize and exploit each fellow's research time and experience, a number of fundamental resources and educational opportunities are available on site to each fellow as listed below.
Based on review of current world lead or lead bismuth test facilities and research needs listed in the Generation IV Roadmap, five broad areas of requirements were identified as listed below:.
Following review of the data and the expert meeting of stakeholders from EAC Partner States, a series of general recommendations were made as listed below.
Suggested improvements and possible testing issues were discussed as listed below: Perhaps the ERCC set should include different types of controls (less than 100 bp or no polyA tail) that would support new labeling technologies or gene expression applications.
In the reference list, references 1 and 2 were listed in the wrong order; this has now been corrected as listed below.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com