Sentence examples similar to were added underlined from inspiring English sources

The restriction sites of BamHI GGATCC, XhoI CTCGAG and SpeI ACTAGT (sequence in small letters underlined) were added to the end of the primer for conventional cloning.

Restriction enzymes sequences (underlined) were added to the primers to facilitate the subcloning (PstI in the forward primer, EcoRV in the reverse primer).

Pieces of neutral sequence [ 17] were added to the 5'-end (underlined in Table 1) of the unlabeled antisense primers for amino acid positions 154 and 171.

We started with a forward iterative selection procedure, during which variables were added one by one into the underline subset.

Some commentary from other respondents is added to underline the more ubiquitous nature of these coping mechanisms.

BglII and HindIII restriction sites were added at the 5´ ends of sense and antisense primers, respectively, as indicated (underlined).

Consequently, based on a literature review, some identified genes and functional processes that appeared appropriate to the lists obtained by DAVID/GO analysis are added (additions are underlined in figures and tables).

For PP1α an additional K (underlined) was added to the N-terminus to aid coupling to carrier proteins.

To construct pGL1163-2628, pGL2299-2628, pGL2299-2628, pGL2881-2628, and pGL3588-2628, a sequence (5'-AATTCGGTACC) containing the Acc65I restriction site (underlined) was added to the 5'-end of the oligonucleotide primers used for the PCR amplification.

A T7 polymerase site sequence (underlined in GAATTGTAATACGACTCACTATAGGG) was added to the 5' ends of the primers to make sense or antisense probes (Supplementary Data Table S1).

An underline '_' is added below the downlink variables to obtain the corresponding uplink ones.