Sentence examples for we inserted from inspiring English sources

We inserted it into a yeast cell.

We inserted clauses guaranteeing our editorial independence".

And the exciting phase happened when we inserted that into E. coli.

In an update on 8 March, we inserted a paragraph to clarify this was a speculative calculation by the reporter.

To prevent that from happening, we inserted 6 bp (gccacc) in the sgRNA sequence right before the starting codon.

As comments rolled in, we inserted them back into the draft itself in the form of pop-up notes.

To increase our signal, we inserted two more copies in pLCM2, generating a 3xFLAG (GATTACAAGGATGACGACGATAAGGACTATAAGGACGATGACGACAAAGATTATAAAGACGACGATGACAAG) Rat1∆NLS plasmid (pLCM6).

Moreover, we inserted electrodes into the intact associative striatum to record the electrical signals from individual neurons.

We had a test with a Texas AM football game where we inserted an audio ad.

After fifty generations, the genome was extracted and the segment we inserted was sequenced.

We inserted a probe, performed transesophageal echocardiography, and were able to diagnose an aortic dissection.