Sentence examples for was used forward from inspiring English sources

The following pair of primers was used: forward (5' -andCTATTATGGGGTACCTGTATGGAAAGAAGCA-3') and reverse (5'-TCCCAGATAAGTGCCAAGGATCCGTTCACTAATC -3'); PCR was carried out under end-point dilution conditions.

The following primer pair for the PSE gene was used: forward, AGTGCTCAAGGACATCGAGACG and reverse, AGCCACTTCTGCACATTGCTG.

The HotStart Taq DNA Polymerase system (Takara) was used: forward primer: 5'- TGTGGTTTAAAGATAGGAGGTATAGG -3'; reverse primer: 5'- TAATAACAAAAAAACCAAAAAACCC-3'.

To normalize the expression data of the genes, GAPDH was used (Forward primer: 5'-ACTGGTGCTGCCAAGGCTGT-3', Reverse primer: 5'-TCCACCACCCTGTTGCTGTA-3').

To amplify the PCR product of β-catenin, the following primer pair was used (forward primer, 5′-TTTGGCTGAACCATCACAGA-3′; and reverse primer, 5′-TGTTGAGCAAGGCAACCATT-3′).

For detection of Nrf2 gene expression the following primer pair was used: forward 5′-TAC TCC CAG GTT GCC CAC A-3′ and reverse 5′-CAT CTA CAA ACG GGA ATG TCT GC-3′.

For gel retardation the following double-stranded oligonucleotide, corresponding to the NF-κB binding sequence, was used: forward-5'-GCCTGGGAAAGTCCCCTCAACT-3' (Invitrogen, CA, USA) was used.

There is also the matter of the other "extraordinary measure" being used: forward guidance.

The FW / INV ¯ signal controls which control the logic unit is to be used (forward or inverse).

For confirmation following primers were used: forward, 5'- cctcacatcacgccggat -3' and reverse, 5'- cgaaggtttcctgaagcag -3'.

The following primers were used: forward 5'-ATCTCGAGCCCATACATACCA AGCAA -3' and reverse 5'-TCAAGCTTCGGGTTTGCTGTGCTGGTGTC-3.