Sentence examples for was underlined that from inspiring English sources

It was underlined that day by the modest £97,250 paid for another horse portrait by Stubbs dated 1799.

It was underlined that emotion comprehension plays a critical role in adaptive behavior, since it promotes survival and guides human behavior by exerting a direct influence on brain responsiveness and psychophysiological activities.

It was underlined that the oxygen partial pressure acts strongly on the characteristics of the chemical equilibrium and mass transfer, and consequently on the selectivity of vaporization, in other words the separating power of a chemical species from the bulk.

With regard to the cost-effectiveness, it was underlined that the approach adopted in the overall process was "fit-for-purpose," and it delivered high quality outputs and offered good value for money.

In a circular dated 16 September 2013, it was underlined that all education services to be provided in and out of the camps was to be planned, coordinated, and monitored only by the Ministry and the staff appointed by the Ministry locally.

Thus it was underlined that non-discriminatory care and patient confidentiality is a matter of professional integrity: "Those who come here have the right to be treated.

(CTG 400 tracts were cloned into an SfiI site located within a linker sequence (TGGCCACGCGGGCCATTTAAATGGCCATTAGGGCC: SfiI sites are underlined) that was inserted between the termination codon of the β-galactosidase gene and the bovine growth hormone polyadenylation (BGH-PolyA) sequence.

It is underlined that DM, as it presently stands, lacks sound theoretical foundations.

It should be underlined that this study was not focused on technology foresight analysis (TFA).

It should be underlined that, in all cases, we did not observe graphite aggregates.

However, it should be underlined, that language should continue to receive special attention.