Sentence examples for was underlined and from inspiring English sources

Suggestions(1)

Exact(6)

A handwritten sign taped to the door of the R. G. Ortiz Funeral Home on West 72nd Street read, "This is a private viewing for family and close friends only!" The word "only" was underlined and was strictly enforced.

Their advance in the Champions League is already in doubt, their ineffectiveness against European opposition at Highbury was underlined and the shortage of transfer activity in the summer was made to appear ominous.

Focused on both form/content: Sample from ANL8 is a response to essay prompt but unlike ANL7, the teacher provides local correction [the word councilor] was underlined and pointed to the correct spelling of the word counselor, [councilor that's politician], and global feedback such as underlining a phrase, e.g. a background [background only?].

The open reading frame of the DNA encoding PsGrx was amplified by PCR with the upstream primer 5′-CAG GGATCCATGAGTAATGTTGTTTT-3′ (the BamHI site was underlined) and the downstream primer 5′-TAT AAGCTTAGCGTTTAGTGTGGCAT-3′ (the HindIII site was underlined).

However, the existence of discrepancies between branching types and fruiting regularity was underlined, and further research appeared necessary to improve ideotype definition in this species (Lauri and Costes, 2004).

The value of HPV vaccination, of multi-antigen bacterial vaccines for prevention of meningococcal disease, staphylococcal and streptococcal invasive infections, was underlined and a report suggested that mucosal immunisation may be effective as a therapeutic vaccine against Pseudomonas aeruginosa respiratory infections.

Similar(53)

GFP-EHD1 ΔEH 1-4388) was generated using 5′-GCCTCGAGATGTTCAGCTGGGTCAGC-3′ (sense primer, XhoI site is underlined) and GCGAATTCTCACTCCACGTCGTCGATGC (antisense primer, EcoRI site is underlined).

For expression of antisense AtYLMG1-1 gene, a genomic fragment was amplified by primers 5'-ATG theAGATCACAGAGATCTCTAATGGCA-3' (the XbaI site is underlined) and 5'-AGT GAGCtheCTTCAACAGGCGGAATAAC-3' (the SacI site is underlined).

The FKH DNA-binding domain of FoxA2 (nt 432 869) was amplified from rat genomic DNA by PCR using primers DBD-FoxA2_f (5′-GCGGAATTCCGCTCGGGACCCCAAGACGTA-3′, EcoRI site is underlined) and DBD-FoxA2_r (5′-GCGCTCGAGTCCCCGAGCTGAACCTGA-3′, XhoI site is underlined).

For overexpression of AtYLMG1-1, a genomic region containing AtYLMG1-1 orf was amplified by primers 5'-ATG theAGAATGGCCGCCATTACAGCTCTC-3' (the XbaI site is underlined) and 5'-ATG GAGCtheGTTTCAACAAAACCATTAGC-3' (the SacI site is underlined).

In a parallel approach, bgl1 was amplified with primers Bgl1-LguI-f (5′-CAGCTCTTCCTCAGTAAAGTTCCCTAAAGGGTTCATG, LguI-restriction site is underlined) and Bgl1-Eco81I-r (5′-GTCCTGAGGAAGTAAGAACGTTTGGAAATTTACTGTATTC, Eco81I-site is underlined) using pQE-80L::bgl1 as template (Schröder et al. 2014).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: