Sentence examples for was introduced immediately from inspiring English sources

General anesthesia was introduced immediately after the administration, and therefore, the complete time course of the consequences was not demonstrated.

To prevent the expression of full-length V or W protein, a terminator codon was introduced immediately downstream of each RNA editing site by single nucleotide substitution.

In the 5'- and 3'- tag vectors an inframe stop codon was introduced immediately after the EcoRV site or after the HIS tag sequence, respectively.

To facilitate the removal of the N-terminal tag, a TEV protease site was introduced immediately upstream of the CREMP-2Rep sequence by site-directed mutagenesis (Figure S3).

A unique AgeI restriction site was introduced immediately after the 3' of the lac promoter by PCR-based site-directed mutagenesis with a set of primers (pBS-SKa: 5'-GGAATTGTGAGCGGATAACAATTTACCGGTCACACAGGAAACAGCTATGAC Cand-3' and pBS-SKb: 5'CATGGTCATAGCTGTTTCCTGTGTGACCGGTAAATTGTTATCCGCTCACAATTCC-3'); the XhoI and KpnI sites were then deleted by restriction digestion and blunt end ligation.

A Bstz171 restriction site was introduced immediately downstream of the 3' loxP site to facilitate southern screening of ES cells.

The amendment rejected today by the 11-7 vote had recommended that the slots be introduced immediately.

Methanol and air were introduced immediately upstream at inlet of the combustor.

A law to protect cyclists from dangerous overtaking by motorists will be introduced immediately, the transport minister has announced.

The fee will be introduced immediately for new customers and from 1 October for existing cardholders to cover the administrative costs of running accounts left idle.

The Ministry of Defence will accept all its recommendations and Fox will tell the conference that the nurses and telephone counselling will be introduced immediately.