Sentence examples for was introduced further from inspiring English sources
After minimization was introduced further authors introduced methods that were published but were felt to be suboptimal for the application [ 7, 8].
When it was positioned in the bile duct, the sphincterotome was introduced further and bile was aspirated with a 10 ml syringe.
As a control another C to T point mutation was introduced further downstream at −660 to the TSS, but still within the same internal region using 5′ GCCTGGCGCACTCACTTCCGCGTCCCGC TGCCCTCCGG (forward) and 5′ CCGGAGGGC AGCGGGACGCGGAAGTGAGTGCGCCAGGC (reverse).
When Tony Abbott was introducing further border security measures, he was keen to prevent a Labor amendment requiring that a guardian or independent witness be present when disabled or child refugees have biometric samples such as blood, saliva or fingerprints collected.
Howard Sinclair, chief executive of St Mungo's, says the current situation is the result in part of "reduced debt advice services, money advice services, housing advice services," and says the situation will get worse when more cuts to housing benefit are introduced, further reducing the amount available for supported housing.
There are also hybridized populations in many areas where Prosopis has been introduced, further hindering identification (Zimmermann 1991.
Through the education bill we are introducing further measures to strengthen teacher authority and support schools in maintaining good behaviour".
Likewise, the value γ=1,000 was introduced without further explanation.
Internal microscopic force interference was introduced to further investigate controllable polymer nano-papules or nano-wires.
Therefore, the mixed culture of the recombinant T. reesei and Aspergillus niger was introduced to further improve cellulase production and the performance in enzymatic hydrolysis.
In the 2007 survey, an additional weight was introduced to further adjust for nonparticipation in the saliva sample, and we used this weight when it became available.
