Sentence examples for was essentially obtained from inspiring English sources

Exact(1)

Plasmid encoded toxin (Pet) is a serine protease originally described in enteroaggregative Escherichia coli (EAEC) prototype strain 042 whose entire characterization was essentially obtained from studies performed with the purified toxin.

Similar(59)

However, these results were essentially obtained with verbal and visuospatial material.

Quine's New Foundations is essentially obtained from type theory by hiding the types from the syntax.

The results are dual to Theorems 1 and 2 and are essentially obtained from them by using the change of variables (y_{n}=x_{-n}).

Many of the systems studied there, such as the ones in [2, 3, 5 9, 11 13, 17 20, 22 26, 28 31], were essentially obtained as some sorts of symmetrization of scalar ones, and were studied first by Papaschinopoulos and Schinas.

The benefit of combined analyses is essentially obtained when the QTL is segregating in both pedigrees.

Estimations of DIR by head squashes stained by IFA were also performed and similar results were essentially obtained (Additional file 3: Table S1).

Primers: AOX-forw: CGTGAGAACAGTGCCAATGAAG AOX-rev: TCACCGATGGTCAATGCAGTAG DHAS-forw: GCAGGACGTGTACGACTTCTTC DHAS-rev: GTAGGACGCCGTAGCGTATCTC Act1-forw: GGTCATTGATAACGGATCCGG Act1-rev: CACTTGTGGTGGACAATGGATGG Cell lysates were essentially obtained as described [ 51], for subsequent AOX activity measurements as described [ 52].

It is noteworthy that the same sr-values for the test repeatability and reader repeatability were obtained: this indicates that the test is very robust and that for replicates of a sample the same binding, flow, and colour formation are essentially obtained.

The recommendations or testimonials of unpaid Facebook contributors are essentially advertisements, obtained at no cost, that may be monetized by Facebook and its business page creators.

The particle size and size distribution was essentially identical to that obtained in the absence of CBr4.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: