Sentence examples for was employed to insert from inspiring English sources

A multi-gene approach was employed to insert the entire cytosolic MEV pathway into the tobacco chloroplast genome.

The Gibson assembly method94 was employed to insert the PDLP5 and PDLP8 ectodomain coding sequences into an adapted pFAST-BAC1 vector (Geneva Biotech), providing a C-terminal 2x-STREP-9xHIS tag.

To improve CAC1493-1494 deletion rate, ClosTron gene knockout system was employed to insert a DNA fragment as homologous allele at the target site in CAC1494 for homologous recombination.

Site-directed mutagenesis was employed to insert mutations into the upstream, the downstream, or both Sp1 sites in the construct S -207/+259.

The pX-GW plasmid (K Hiramatsu and S Ishikawa, unpublished) was employed to insert the mutagenized sepF fragments, under control of the xylose-inducible promoter Pxyl, into the amyE locus of B. subtilis.

In principle, the TREC method can be employed to insert genes of interest into the Mmc genome.

A PCR reaction with the oligos 5′GGAGAGGGGGAAGCTTGTAA3′and 5′TandAGACTTCGTGGGGTTG3′ and PFU Turbo (Stratagene catalogue number 600250) was employed to generate the insert.

Primer walking was employed to sequence this plasmid with large inserts.

To quantify the amount of H2Se produced, a coaxial insert NMR tube was employed to allow the use of an external77Se NMR standard.

An alkali extraction experiment was employed to test whether Bax phosphorylation at different sites regulates its capacity to insert into mitochondrial membranes.

Selective laser melting (SLM) was employed to fabricate the cold plates where the inserts were integrated to the flow channel walls in a single built piece.