Sentence examples for was done consists from inspiring English sources

The meta-analysis was done consists with recommendations from the Cochrane Collaboration and the PRISMA Statement [11] with standard software (Revman 5.0 and Stata version 10.0).

A field study was done, consisting on the application of surveys.

For every patient enroled, a complete diagnostic evaluation was done consisting of chest X-rays, mammography, liver ultrasonography and whole-body bone scan to exclude distant metastasis.

Due to the insolubility of the proteins, an additional step was done consisting in a ClGn-6 M extraction and finally an additional purification step in a column prepacked with Ni Sepharose (His GraviTrap™ from GE Healthcare, Buckinghamshire, UK) was carried out.

For each morph, three experimental replicates were done, consisting each of batches of 10 individuals which were frozen in liquid nitrogen 48 h after adult moult and used for RNA extraction.

For Constabile and Verizon, what's next in the context of what the Media Lab is doing consists primarily of an interest in augmented reality and other next generation technologies at the intersection of media and technology.

James goes onto claim that there is a wide range of cases in which paying attention to what one is doing consists in this same sort of preparatory imaginative engagement.

This was done randomly, consisting of both morning and evening handovers over a period of a week by a staff specifically chosen for this job from another ward to prevent bias from the hawthorn effects and ensure validity.

This comparison was done using a reference set consisting of protein coding sequences available in GenBank that are putatively expressed in the bloodstream stage.

Amplification of 411 nucleotides of the mt D-loop sequence was done with a primer set consisting of upstream primer myt001 (5' GAGAAAGACTTAAACCTTC 3'), and downstream primer myt003 (5' GACAAAACAACCAAAGGCCAG 3'), based upon corresponding sequences from Geochelone nigra (Genbank accession numbers AF192942 – AF192942).

The selection was done by a committee consisting of the school coordinators and school social workers.