Sentence examples for was doing forward from inspiring English sources

The toughest was doing forward rolls for 12.25 miles, only stopping to throw up.

Nancy: He was interested in using transposable elements to tag genes that could then be cloned – basically, he was doing forward-genetic screens in flies.

To ensure the absence of a DNA contamination within the isolated RNA a PCR amplification with the porcine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was done (Forward primer: aagcagggatgatgttctgg; Reverse primer: atgcctcctgtaccaccaac).

"The only thing that's annoying is that it's taking away from what we're doing," forward Richard Jefferson said.

PCR amplification of RUNX3 was done using forward primer; 5'-CAGAAGCTGGAGGACCAGAC-3' and reverse primer; 5'-TCGGAGAATGGGTTCAGTTC-3'.

PCR amplification of 100 ng DNA was done using forward primer end labeled with Fam.

The selection of positive clones by colony PCR was done using forward and reverse primer screening (sites flanking pSMART21F inserts).

Linguistic validation of the CCTDI and the HSRT was done by forward and backward translation by two independent translators.

"She knows what she's doing," Notre Dame forward Devereaux Peters said.

"We definitely got a feel now for what they're doing," Celtics forward Paul Pierce said.

"This is something we should be doing going forward".