Sentence examples for was considered to function from inspiring English sources

Since the observed phenomenon can be explained by the absence of the pre*s element from the resulting transcript, Ptet-T6 was considered to function independent of the orientation.

We did not examine miR-133b because it was considered to function similarly to miR-133a; these microRNAs have very similar sequences (miR-133a: UUGGUCCCCUUCAACCAGCUGU, miR-133b: UUGGUCCCCUUCAACCAGCUA) and have a common sequence for binding to FSCN1 mRNA (UUGGUC).

Historically, MMP-2 was considered to function on extracellular matrix substrates; however, several reports recently showed that the detrimental effect of MMP-2 may occur primarily within the myocytes.

LeSUT2 is considered to function as a putative sucrose sensor (Barker et al. 2000).

In this way, SE5 can be considered to function as type of phase boundary marker in this co-text.

Small-scale UAVs are being considered to function as wireless relays to enhance the performance of cellular networks [9, 10] and satellite communication systems [11].

Deposition of lignin during defense responses is considered to function as a physical barrier against pathogen infection (Moerschbacher et al. 1990).

Active calpain is considered to function by cleaving proteins that are constituents of adhesions [5], [6].

Because high ODC activity is associated with the majority of human malignancies [20], AZ is considered to function as a tumor suppressor.

But, to our knowledge they have never been considered to function as two modalities of the same TPC separated by acoustic frequency.

Wheat mitochondrial AOX is considered to function in OS alleviation processes under low temperature conditions and in the Ne1-Ne2-type (type I) hybrid necrosis [24], [44].