Sentence examples for walking upstream from inspiring English sources

As students poured out of the school, Saujani, walking upstream, made her way to the fourth floor.

In less than a half hour I landed four large fish-one more than eight pounds-and began walking upstream to look for new water.

I walked upstream, drifted my fly over it and was connected to a bright 13-pounder.

Return to the south bank, walk upstream or downriver and you might reach Dilston Grove, at the south-west corner of Southwark Park.

In summer, we swim up and down but in the winter we walk upstream and have a float down with the current.

I walked upstream, where the river deepened and slowed, and tied on a fat, rubber-legged stimulator with a tomato-red belly.

Trying to hail a cab, I walked upstream from an intersection where other people were already waiting and intercepted one before it reached the corner where I'd been standing.

Head south on Camino del Rio, park at the Durango Visitor Center (111 South Camino del Rio, 800-525-8855), waboutpstream about 100 yards along the bike path and look for the small crowd gathered at Smelter's Rock for a front-row view.

The following nested primers were used to walk upstream; 5'GGGTCCTTCTCGTTGATGTGCC3', 5'TCGTTGandTGCCCGTTGCC3' and primers used to walk downstream were; 5'TGGGGATCAGCCAGGGCAAG3', 5'CAAGCCGCTGCCCATCAACA3'.

Primers used for the P. coffeae fragment were Pc-eng1-up1 (TTGGAGTCAATGGCCCGGATGG), Pc-eng1-up2 (GATGTTCGGATTGGAGCCATATTGC) to walk upstream en Pc-eng1-down1 (TCAAATCTCTGCTACACTCTCCAC) and Pc-eng1-down2 (CAAACAATCCCTCAGGGATAAGGC) to walk downstream.

Genome walking to upstream was employed in Pru p/du 2.02 to search for more polymorphisms and downstream to Pru p/du 2.03, since its initial reference sequence was partial.