Sentence examples for walk downstream from inspiring English sources

Where to stay: Patrick Punchs (patrickpunchshotel.com, +353 61 460 800), a short walk downstream from the centre.

Taking final leave of our site, we walk downstream to the swampy lowlands at the western end of the woods.

If you'd emerged from a building a few hundred feet upstream of someone seeking a cab, you'd have no obligation to walk downstream and defer to them.

To reach them walk up the forest path from Pontneddfechan's Angel Inn or park at Pont Melinfach car park, off the Ystradfellte road, and walk downstream.

We used this technique to walk downstream into the isochorismatase and upstream into the hypothetical conserved genes flanking the mature extracellular lipase gene from Bacillus licheniformis.

The following nested primers were used to walk upstream; 5'GGGTCCTTCTCGTTGATGTGCC3', 5'TCGTTGandTGCCCGTTGCC3' and primers used to walk downstream were; 5'TGGGGATCAGCCAGGGCAAG3', 5'CAAGCCGCTGCCCATCAACA3'.

When she woke up, Layton was out in the river again, walking downstream and casting at the banks.

Walking further downstream, movement on the opposite bank caught my eye.

Sit and spot otters, herons and oystercatchers then walk the mile downstream to Kelso for a pub lunch.

Alternatively walk or swim downstream from Pangbourne – it's six miles back to Reading – taking in the meadows with views of the historic Mapledurham house.

The upstream walking product of 0.5 kb amplified by adh-up and EcoR-dep (Fig.  2B-c, lane 8) and downstream walking product of 0.9 kb amplified by adh-down and Nco-dep (Fig.  2B-c, lane 9) were cloned for sequencing, respectively.