Your English writing platform
Discover LudwigSuggestions(2)
Exact(2)
A second approach used by some researchers is an in vitro version of the peptide reactivity assay (PRA) described above, which has more commonly been performed as an in chemico analysis.
Accumulated Nf1 inhibits Ras activity and the Ras-MAPK signaling pathway, thus preventing ES cells from undergoing endothelial differentiation in vitro to form blood island structures (the in vitro version of in vivo vasculogenesis), and inhibiting in vivo angiogenesis and proliferation in teratomas upon injection of the mutant ES cells into nude mice.
Similar(57)
The similarity of results in the cross platform evaluation and within tissue repeatability was instrumental in the selection of the NanoString nCounter Dx Analysis System as the platform for development and training of the in vitro diagnostic version of the PAM50 classifier.
Yoon et al. [ 10] showed that Kaiso can bind in vitro to a methylated version of the sequence GGCGCGCGAGTCTTTGGGGCGCG, which is found within the CpG island promoter of the MTA2 gene.
In particular we demonstrate that in vitro, the wild-type version of the Tetrahymena ribozyme is not interpretive, in that it cannot use Ca2+ as a sign for Mg2+.
Though the grant was small, it has helped turn the Netherlands into the in-vitro-meat world's version of Silicon Valley.
Another version of in vitro mutagenesis is gene disruption, or gene knockout.
For example, purified fragments of pFN corresponding to the 120- to 140-kDa central cell-binding domain (CBD), the 50-kDa gelatin-binding domain (GBD), and the 40-kDa C-terminal HBD have each been observed to trigger release of proteoglycans from cartilage slices in vitro, as has a recombinant version of the alternatively spliced EIIIA segment (Fig. 1) [ 18, 22, 25- 27].
The greatly enhanced in vitro ADCC activity of the glycoengineered version of hPR1A3 is likely to be clinically beneficial.
AS602868 is an anilino-pyrimidine derivative and ATP competitor selected for its inhibitory effect in vitro on IKKee, a constitutively active version of IKK2.
Next, to elucidate which of the seven in vivo phosphorylation sites can be phosphorylated by AKIN10, we performed in vitro kinase assays using the wt version of bZIP63 and different serine to alanine (S/A) mutants as substrates.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com