Sentence examples for viruses was determined using from inspiring English sources
The 50% inhibitory concentration (IC50) analysis of oseltamivir for influenza A/H1N1 viruses was determined using the NA-Star Influenza Neuraminidase Inhibitor resistance Detection Kit (Applied Biosystems) according to the manufacturer's recommendations.
Traditionally, receptor specificities of avian- and human-adapted influenza viruses are determined using a red-blood cell (RBC) agglutination assay.
To further characterize the single-point M1 mutants, the growth kinetics of these viruses were determined using Darby Canine Kidney Epithelial Cells (MDCK) cells.
The titers of the EV71 and CA16 viruses were determined using the Reed and Muench method to analyze the cytopathic effects observed in infected RD cells and were expressed as 50% tissue culture infectious doses (TCID50).
DNA levels of amiRNA-expressing recombinant viruses were determined using a TaqMan primer/probe set specific for the adenoviral hexon gene (hexon-fwd 5′- CACTCATATTTCTTACATGCCCACTATT-3′, hexon-rev 5′- GGCCTGTTGGGCATAGATTG-3′, hexon-probe 5′- AGGAAGGTAACTCACGAGAACTAATGGGCCA -3′).
The LD50 of PR/8 virus was determined using the method described by Reed and Muench [47] where one LD50 was found to equal 250 pfu of PR/8 virus.
The 50% tissue culture infectious dose (TCID50) for the M-tropic virus is determined using PBMCs.
The infectious units (ifu) for the virus were determined using the Adeno-X rapid titer kit (Clontech, USA) according to the manufacturer's protocol.
The haemagglutination titer of the virus stock was determined using group 0 fresh human blood red cells according to the WHO protocol [23].
Recombinant lentiviral vectors were packaged using the ViraPower™ Lentiviral Packaging Mix (Invitrogen), after which the virus titer was determined using a HIV-1 p24 ELISA KIT (PerkinElmer Life Sciences, Boston, MA, USA).
The protein content of the virus preparation was determined using BioRad DC Protein Assay reagents (BioRad, Hercules, CA) and bovine serum albumin as a standard in a microplate format.
