Sentence examples for verified in specific from inspiring English sources

Suggestions(1)

Exact(1)

Theoretical predictions have been verified in specific models such as Boolean networks, liquid state machines, and neural networks.

Similar(59)

Furthermore, this finding was further verified in a specific autophagy inhibitor BAF-induced autophagy inhibition, suggesting that p62 had a critical role in autophagy inhibition-mediated ER stress.

As the reader may verify in a specific publication about the employed extraction [28], such re-arrangement is highly beneficial to quality of the extracted terms.

In order to verify if specific classes of proteins are differentially enriched in the RGP or Met libraries, we submitted the two total lists of genes identified in our SSH libraries to a functional annotation based on the Gene Ontology, according to the biological processes.

In order to verify if specific functional classes of genes tend to have differences in the transcript structure between strains we performed a Gene Ontology (GO) analysis.

The practical implication of this voluminous information would be to create "stem cell niche biobanks," wherein data that has been rigorously tested and verified in the requirements for specific factors for the maintenance of stem cells of all tissue types can be consolidated.

We then verified in cell culture their specific binding in a complex cellular environment and found an affinity cut-off in the mid-nanomolar region, above which binding is no longer detectable in the cell.

10 11 12 However, in cross sectional studies, cancer status is not verified in men with prostate specific antigen concentrations below the threshold for biopsy, so such studies cannot provide accurate estimates of sensitivity.

While these projections from our findings seem consistent with respect to the existent literature on culture [3], [5], they are still speculations that should be verified in studies of even more specific mechanisms of cultural differences in visual processing and the impact on memory for visual details.

Although computer analysis provides predictions about what these factors might be, these predictions will need to be verified in future studies using factor-specific antibodies and purification procedures.

The stable replication of this plasmid in Dsl 9019 was verified in sub-cultures using plasmid-specific primers (pF1: cagcgaagagcaagacaa, pR1: tcatggaagcgatctcgg and pF2: ttaccggacgccgagctgtggcgt, pR2 :caggaagatgtcgttatcgcgagt).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: