Sentence examples for venus by from inspiring English sources

HOTTENTOT VENUS, by Barbara Chase-RiBarbara

THE BIRTH OF VENUS, by Sarah Dunant.

10 9 6 THE BIRTH OF VENUS, by Sarah Dunant.

Birth of Venus by Sandro Botticelli.

Aphrodite, ancient Greek goddess of sexual love and beauty, identified with Venus by the Romans.

The Book Club is reading "The Transit of Venus," by Shirley Hazzard, in June.

"Voyage of the Sable Venus," by Robin Coste-Lewis, especially the title poem.

And the massive choral work, Vigil of Venus by Cornishman George Lloyd.

He also loves "The Rokeby Venus," by Velásquez (2), in the National Gallery.

Serena also appeared more deeply affected than Venus by their sister's death in 2003.

From the starting material CFPΔ-EPAC-cp173Venus-Venus [6] and mTurquoise we generated mTurquoise-EPAC-cp173Venus-Venus by inserting mTurquoise with forward PCR primer GATCGGCGGCCGCAATGGTGAGCAAGGGCGAGGAG and reverse primer GATCGATATCCCTTGTACAGCTCGTCCATGCC.