Suggestions(1)
Exact(1)
To determine extended duration of genomes, Jurkat cells were exposed to GFP-vpr tagged vector, washed with pronase, and propagated in culture for 4 additional days.
Similar(59)
After washes in PBS-X, the sections were incubated for 90 min at room temperature with anti-rabbit secondary antibodies (1∶500, Vector), washed in PBS-X, exposed to an avidin-biotin complex (Vector) for 1 hr, washed again in PBS-X, and stained using diaminobenzidine (Sigma) enhanced with 0.008% nickel chloride.
Twelve hours later, cells were transfected with 6 µg of HIV Env expression vector pNLΔGag and washed with PBS four hours' later.
A549 cells stably transfected with pCDNA-SPRY4-IT1 or the empty vector were harvested, washed with phosphate-buffered saline, and resuspended at 2 × 10 cells/ml.
COS7 cells transfected with pQBI25-L13, -L24 or -L32 or vector alone, pQBI25, were washed with phosphate-buffered saline without Ca2+ and Mg2+ (PBS and fixed with 4% paraformaldehyde for 30 min at room temperature.
After co-cultivation of Agrobacterium carrying the pGU.C.US vector, infected calli were washed with sterilized water seven times and with 12.5 mg/L meropenem three times.
For colorimetric staining, slides were then incubated in 3,3'-Diaminobenzidine (DAB; Vector Laboratories; Burlingame, CA, USA), washed with PBST, counterstained with hematoxylin, and rinsed with deionized water.
Forty eight hours after vector transfection, the cells were washed with DPBS containing calcium and magnesium and then lysed using 1× Passive Lysis Buffer (Promega), according to the manufacturer's instructions.
The qPCR primers were as follows: p62-1, CAGAGAATACCTTTGCCTCCCA; p62-2, AATCTTGGAGCTCCCCATGTC; parkin-1, ATTCAGAAGCAGCCAGAGGTC; parkin-2, CTGGCACTCACCACTCATCC. SH-SY5Y cells transfected with parkin-Myc or Myc-vector grown on coverslips were washed with phosphate-buffered saline (PBS) and fixed in 4% formaldehyde in DMEM for 30 min at 37°C.
Briefly, at 24 h after transfection with vectors, SiHa cells were trypsinized and washed with cold PBS, and then resuspended in 100 μL 1× binding buffer at 1 × 106 cells/mL.
The sections were subsequently washed with PBS and mounted with Vectashield mounting medium (Vector laboratories, Inc. Burlingame, CA, USA).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com