Sentence examples for vector using the from inspiring English sources

A novel technique is developed for evaluating the interface normal vector using the distance function.

Before each algorithm's execution, we determined the optimal scale vector using the genetic approach.

The promoter, ORF and terminator of TRP1 were PCR amplified from a Mumberg p424 vector using the primers TRP1_gpd1Over_f, TRP1_gpd1Over_r.

The purified products were cloned into pJET1.2/blunt cloning vector using the CloneJET PCR Cloning Kit (Thermo Scientific).

PCR fragments were cloned into pESC-Leu2d empty vector using the Xho1 and Nhe1 sites.

The amplified PCR products were cloned into the pCR2.1 vector, using the TA cloning system (Invitrogen).

The TK probe was amplified from the pHTK vector using the primer pair GGCCCGAAACAGGGTAAATAACG/CTTCCGAGACAATCGCGAACATC.

The transgene was subcloned into a K14 vector using the BamHI and XbaI sites (Fig. 1A).

The insert was fully sequenced and then recombined into the pDEST-17 bacterial expression vector using the Gateway system (Invitrogen).

The bulk PCR product was then cloned into pCRII vector using the TOPO TA cloning kit (Invitrogen).

The B16 cells were transfected with either Stat3C vector or control vector using the Lipofectamine method as described [43].