Sentence examples for vector use from inspiring English sources

However, even if the gene is eliminated after transient expression from a viral vector, use of the viral vector is associated with risk of insertional mutagenesis leading to cancer or other cellular dysfunction.

To clone the P. falciparum nudA gene into an S. pombe expression vector, use PCR to amplify nudA from a cDNA clone or library with primers whose 5′ ends contain 45 60 bp of sequence found on either side of a unique restriction site that is downstream of a promoter in a replicative S. pombe expression vector such as pART1 (McLeod et al. 1987) or pREP1 (Maundrell 1993).

6) Compute the translation vector using (37).

Originally, the regression vector used for recursive estimation is (21).

Length of feature vector using N=8 Descriptor Dim.

A novel technique is developed for evaluating the interface normal vector using the distance function.

These coefficients are predicted by minimizing the norm of the residual vector using genetic algorithms.

EV, empty vector; Control, vector used for transformation without the Z3 gene.

The HAC vector used in this study was 21HAC1 [39].

PCR products were cloned into pCR2.1-TOPO vector using TOPO TA cloning kit (Invitrogen).

The TK probe was amplified from the pHTK vector using the primer pair GGCCCGAAACAGGGTAAATAACG/CTTCCGAGACAATCGCGAACATC.