Your English writing platform
Discover LudwigExact(8)
The gRNA sequence KN211163G1, PTPRS gRNA vector 1 in pCas-Guide vector, (target sequence: CTTGTGGTCCTGCTCGTTGG) proved the most effective at knocking out (KO) PTPRS expression and was thus used to create the HCT116, HT29 and SW620 PTPRS KO cell lines.
Negative controls were transfected with empty vector target sequences and pcDNA plasmids at identical concentrations.
The sequence was trimmed to delete the 5' region corresponding to the TAR vector target fragment.
In contrast, the impact of host cell genetic/epigenetic conditions on vector target site selection in vitro and in vivo is often overlooked in GT clinical studies.
In vector-containing mammalian cells, treatment with Cr VI) also results in a dose-dependent increase in mutations in the vector target gene supF.
Promoter sequence was trimmed to delete sequence corresponding to the region of the BES promoter present in the pEB4 TAR vector target fragment.
Similar(52)
We report that homologous recombination using a promoterless gene trap vector ("targeting trapping") yields targeting frequencies averaging above 50%, a significant increase compared with current approaches.
(c) Representative flow cytometric chart showing percentage of LSK HSC BM CD45+ donor cells, transduced with a negative control vector (SC shRNA, upper panel), or an shRNA vector targeting Nap1l3 (Nap1l3 shRNA, lower panel) in recipient mice five weeks post transplantation.
This vector targets the gene Rv0168.
A siRNA vector targeting GFP was used as a control.
Vector targeting in vivo is of paramount importance in gene therapy.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com