Sentence examples for vector same as from inspiring English sources

Suggestions(1)

Exact(1)

The constrained least-squares problem can be solved by introducing a Lagrange vector, same as the way in (16).

Similar(58)

Here, m, n ∈ ℤ and both are shift parameters, while ( {C}_i^k ) is an r-dimensional vector (the same as below).

850 hPa temperature anomalies are shown as contours and mean winds as vectors (h) same as (e) but advection of anomalous temperature by anomalous winds (shaded).

Contours represent mean temperatures and mean wind at 850 hPa is shown by vectors (f) same as (e) but advection of mean temperature by anomalous wind (shaded).

It is the unique maximally symmetric curved space-time with ten Killing vectors (the same as the Minkowski space-time) and locally characterized by the following: R μ ν λ ρ = 2 ⋀ ( n − 1 ) ( n − 2 ) ( g μ λ g ν ρ − g μ ρ g ν λ ).

From the definition of the unit vector, we know that the initial point and direction of the unit vector is the same as the given vector A. Furthermore, we know the length of the unit vector is 1.

So for this first rectangle, the origin turns out to be the origin of the original rectangle, and the vertical vector is the same as the vertical vector of the original rectangle.

The sgRNA target sequence of PRMT5-CRISPR-2 (GAATTGCGTCCCCGAAATAG) falls on the exon 1 of the mouse Prmt5 gene, while that of PRMT5-CRISPR-3 (CCCGCGTTTCAAGAGGGAGT) falls on the exon 2. Two sgRNAs targeting the DNA sequence of the EGFP gene (GGGCGAGGAGCTGTTCACCG for EGFP-CRISPR-1 and GAGCTGGACGGCGACGTAAA for EGFP-CRISPR-2) were also cloned into the same vector, respectively, as used as control.

In order to have better generalization, the model was designed to realize a supervised learning such that after learning, output for any input vector is the same as the output of a higher order network that implements the same input data set using M̃ number of higher order terms.

On the other hand, the relaxation time of the normal mode reflecting the fluctuation of the end-to-end vector is the same as the neat polymers but the intensity of the relaxation process increases due to enhancement of the internal electric field by MM.

In this case, the nulling vector is the same as the conjugate of the (N - i + 1 th column of Q matrix, i.e.e.e

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: