Sentence examples for vector in three from inspiring English sources

Exact(3)

The value of (xi ) depends on the momentum of the particle through the spatial diffusion coefficient, begin{aligned} k_2 = <frac{ v_x tau )^2}{2 tau }>=frac{v^2 tau }{6} =frac{tau c^2 p^2}{6(m_0^2 c^2 + p^2)}, end{aligned} (8 where denotes the ensemble average, and (v_x) is the x component of the velocity vector in three dimensions.

To test the effects of TFEB overexpression on muscle pathology in PD mice, 1-month-old GAA−/− mice received direct intramuscular injections of an AAV2.1-TFEB vector in three sites of the right gastrocnemius muscle.

You can find the magnitude of a vector in three dimensions by using the formula a2=b2+c2+d2, where a is the magnitude of the vector, and b, c, and d are the components in each direction.

Similar(57)

Target specific gRNAs (T1- gcgagtatcttatctcaagt; T2- gttaggtaggaggggcagat) then were cloned into the pX335B vector in two cloning steps.

The ability of the diblock copolymers to deliver pDNA was subsequently investigated using a GFP expression vector in two monocyte cell lines.

The state space approach recursively estimates the state vector in two consecutive stages: prediction and updating.

In addition, we measured Luciferase activity for an empty (i.e., with no promoter) pGL4.14 vector, in five replicates, in order to estimate background Luciferase transcription levels.

We have shown here that inserts from nine separate plasmids (or nine sets of modules) can be easily and efficiently assembled and cloned in an acceptor vector in one step and one tube.

As shown in Fig. 4B and 4C, p16 over-expression in GR but not in NG cells caused a significant increase in senescent cells compared with the cells transfected with mock vector in WI-38 cells, which implied that p16 amount is more critical in senescence regulation under GR rather than NG.

With this pipeline, four 96-well plates of genes could be cloned into an expression vector in seven days.

These results were further verified through transfection of an antisense Id-1 vector in two ovarian cancer cell lines with high levels of Id-1.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: