Sentence examples for vector immediately from inspiring English sources

Exact(11)

To satisfy these needs, the electrophoresis buffer must be prepared with sterilized ultrapure water, the eluted DNA should be quantitatively analyzed to satisfy the optimal ratio between DNA and BAC vector, and the DNA should be ligated with the BAC vector immediately.

The c-Rel-silencing oligonucleotides were first cloned into the pEGFP-mU6-1 vector, immediately downstream of its U6 promoter (Fig. 1a) [74], [74].

The 3'UTR or mutant 3'UTR of ERK5 were cloned in the XbaI site of the pGL3-Control Vector, immediately downstream of the stop codon of luciferase coding sequence.

To clone heterologous PPARA variant promoter-reporter constructs, (−54,642A 2c.TK.Luc and (−54,642G 2c.TK.Luc, double-stranded fragments corresponding to the probes used in EMSA were 5' phosphorylated then ligated into the BamHI site of a luciferase expression vector immediately upstream of the thymidine kinase minimal promoter of the pGL2.TK.Luc reporter plasmid.

The sequence in the pRSET B vector immediately between the nucleotide 5′ of the ATG start codon and the sequence 5′-GATCCGGCTGCT-3′ near the T7 terminator was replaced by the following insert.

Mkrn1 protein-coding cDNA was amplified, digested with PvuII to generate blunt ends, and ligated into the pCAGGS::FLAG vector, immediately downstream from the FLAG epitope to yield the pCAGGS::N-FLAG MKRN1 N-FLAG MKRN1

Show more...

Similar(49)

In practice, a lattice is converted to an n-gram super-vector immediately after it is generated, so the storage requirement does not increase significantly.

The engineered constructs consisting of PCR-amplified DNAs were cloned into binary vector pJL89 immediately downstream of a double cauliflower mosaic virus (CaMV) 35S promoter, and upstream of the hepatitis delta virus (HDV) ribozyme and nopaline synthase terminator (NOS).

Specifically, the diagnostic sequence elements for cDNA termini include adapter/linker sequences, insert-flanking restriction enzyme recognition sites, poly (A)/(T) tails, and plasmid vector fragments immediately adjacent to cDNA inserts.

The 3′UTR of DNMT3A containing an intact miR-143 recognition sequence was amplified and the PCR product was sub-cloned into a pGL3 vector (Promega Corporation) immediately downstream of the luciferase gene.

Briefly, PCR products were obtained with a forward primer containing the T7 promoter (either the universal primer which anneals to the vector sequence immediately upstream of insertions, CGCCGTAATACGACTCACTATAGGGAGCTTATCGATACCGTCG or the T7 promoter-containing gene specific primer) and reverse primer containing an oligo dT) stretch of 50 nt T50AACTTGTTTATTGCAGCTTATAATGG.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: