Sentence examples for vector forward from inspiring English sources

Fish, eyeless and lacquered, vector forward like spiky bronze dragons; seahorses ride high in their glass vitrines; nameless serpentine forms turn gold in the museum light.

Similar strategy was used to clone Fam20a and Fam20aΔ23 in the pcDNA3.1 vector (Forward primers were same as above; Fam20a and Fam20aΔ23 reverse primers: 5'GGCAAGCTTGGGCTCGTCAGATTAGCCTG3').

Resulting mice were screened for BAC integration by PCR with primers designed against the vector: forward 5′-ataaatggatgccctgcgta-3′; reverse 5′-ttcaacccagtcagctcctt-3′.

One clone was sequenced using ABI Big-Dye reaction mix (BigDye 3.1) using the vector forward and reverse primers and also internal primers (nomet1134R: 5'-TTTAAGTTTCAGCCTTGCG-3' and SR4Eug: 5'-ACTGGAGGGCAAGYCTGGT-3') oriented in both directions.

Assuming that the training symbols are independent of the data symbols, we define P S = 1 ( M + 1 ) N ( x S H x S + E [ y H y ] ), and P R = 1 ( M + 1 ) N ( x R H x R + E [ w R H w R ] ), where w R H is the signal vector forwarded from the relay node.

The EnKF propagates an ensemble of state vectors forward in time and updates the state vectors as measurements become available.

The entire aircraft must be tilted to give the thrust vector a forward component to achieve forward flight.

The incorporation of the gene into the vectors was confirmed by PCR amplification of the gene fragments from the recombinant plasmid templates with vector specific forward and reverse primer against respective gene forward or reverse primers and 1(d)).

BAC clones were also subjected to end sequencing using pCC1 epicenter vector specific forward and reverse primers: pCC1™ / pEpiFOS™ forward sequencing primer (5′ GGATGTGCTGCAAGGCGATTAAGTTGG 3′) and pCC1™ / pEpiFOS™ reverse sequencing Primer (5′ CTCGTATGTTGTGTGGAATTGTGAGC 3′; Invitrogen).

from Equation 17, where c x is a bias vector of forward inference for the source speaker.

When a participant would start to draw a vector the forward button was held down on the clicker and that button was released when the vector was finished.