Sentence examples for variants at both from inspiring English sources

In this model, the group mean for double-risk individuals was 15.8 points (1.05 SD) below that of individuals carrying nonrisk variants at both loci (Table 3).

Here, we try to replicate the association between AD risk and ABCA7 loss-of-function variants at both the single-variant and gene level in a large and well-characterized European American dataset.

Thus there are two major advantages to iterative remapping: locally, enhanced detection of variants at both high and low frequencies in areas with dense mutation rates and globally, significantly better estimates of variant frequencies.

Directional selection leads to genealogies with both star shapes (leading to the common ancestor of the selected lineages) and long branches (due to remaining ancestral lineages and/or recombination with the selected haplotype), and generates an excess of variants at both low and high frequency (Barton 1998).

Such debate as to the processing of OPA1 arises because of the large number of splice variants (at both mRNA and protein level), cleavage being mediated by several different proteases, and cleavage occurring in response to both profusion and pro-apoptotic pathways.

Among subjects with one or more variants at both of the XPD polymorphisms, there was a 2-fold risk of SCC (OR = 2.2; 95% CI, 1.0 5.0) or those with high arsenic (> 0.286 μg/g) relative to those with lower arsenic.

White-eyed flies possess either variant at both markers.

Having at least one variant at both XPD polymorphisms was observed less frequently in both BCC and SCC cases than in controls.

TT genotype was not observed in both CD patients and HC and only one individual carried the 399Ile variant at both alleles in UC.

Since the Pyrocystis H3 variant seems to be among numerous genes whose expression profiles are affected by oxidative stress [ 38], evidence exist at least for this H3 variant at both the genomic and the transcriptional level.

When we performed a blastn search of GenBank using a text string that included the minor sequence variant at both positions (ATTCTTCAAATATCTACTCATT), three of the 20 fully matching human results represented a NUMT on Chromosome 13.