Sentence examples for variant consisted of from inspiring English sources

The second variant consisted of Δ1 40 torsinA, which eliminates torsinA retention to the ER (Liu et al., 2003).

Screening of normal control individuals (male and female) for the ZC4H2 c.197T > A variant consisted of utilizing allele specific amplification (ASO) using primers: ZC4H2 ASO K8070F 5′ASOGCCCATGTGGAGGAtCa 3′; ZC4H2 ASO K8070R 5′CACTACCACAGCCTGCACTGA 3′.

The main improvements of the ODS variant consist of higher cyclic stress level and lower cyclic softening.

The 101 compound twinning was also considered to be a deformation twin which was introduced as result of elastic interactions during the transformation since the twin had an isolated fashion in the martensite variant consisting of 111 Type I twins.

A genetically engineered apoferritin variant consisting of 24 heavy-chain subunits (HFn) was produced to achieve a cumulative delivery of an antitumor drug, which exerts its cytotoxic action by targeting the DNA at the nucleus of human cancer cells with subcellular precision.

The two-column distillation variant consists of a beer column and a rectification column.

Other variant consists of the generalisation of such models by incorporating point and/or distributed delays [8, 10 12, 14].

All seven quasi-monomorphic loci possessed only one type of variant consisting of one-base insertion or deletion.

MMP16 is also known to have a splice variant, consisting of a soluble form lacking the transmembrane domain.

The FL-L1CAM variant consists of six immunoglobulin-like domains (Ig1-6), fibronectinectypetype III repeats, and a short cytoplasmic tail.

The predicted cardiac AE3 (AE3c) polypeptide is 1030 amino acids in length and approximately 120 kDa, while the AE3fl variant consists of 1227 amino acids and ∼160 kDa.