The CT value of ACT1 (amplified with the forward primer 5'-CAACAAGGACAATACAATAG-3' and the reverse primer 5'- GTTGGTGGACGAGAATAATG -3') was subtracted from that of the tested genes to obtain a ΔCT value.
The value of these visualizations is amplified by the faceted browsing technique, allowing the user to remove any of the pages that do not match their filters.
The reward value of food can be amplified in genetically vulnerable individuals, but it can also be increased by environmental factors (40).
BLAST and GenBank (GenBank and WGS Statistics; https://www.ncbi.nlm.nih.gov/genbank/statistics/) were essential tools for sharing and searching sequencing data, vastly amplifying the value of each sequence to the field.
Loss amplifies the value of what remains.
Another major lesson is that loss amplifies the value of what remains, pushing you to take stock of what you have and to celebrate your assets.
"The opportunity to amplify the value of your commercial beyond game day is invaluable," said Joshua Stylman, managing partner at Reprise Media, a research company that tracks how advertisers use search-engine marketing on Web sites like Google and Yahoo to complement their TV campaigns.
Henry Ford once complained, "Why is it that every time I ask for a pair of hands, they come with a mind attached?" But these days, of course, minds dramatically amplify the value of hands—and they become even more powerful when they're able to engage with minds outside the company.
Second, the assignable cost of "backup" is modest and indeed can work either way: it amplifies the value of solar power in areas with air-conditioning peaks and the greater output of wind during winter enhances its value per megawatt hour in northern Europe, for example.
The app will also show donors how the value of their contributions can be amplified by the city's matching funds program for small contributions; under the city's voluntary program, small contributions are matched 6 to 1, so the app will show donors of $10 that their contribution could bring the campaign $70.
It's about building a community around the developer where each member will amplify the value of the core service.
