Sentence examples for utilizing the forward primer from inspiring English sources
COI sequences were obtained utilizing the forward primer LCO1490 [ 37], and the reverse primers HCO2198 [ 37] or COX-B7R [ 38].
All polymerases utilized the same forward primer (5'-GCATGGCCTCAGTGGCCTCTGCATNNNNNN-3') covering 6 nucleotides of the 12 N random portion of the template.
A 169-base-pair DNA fragment of the factor V gene that includes nucleotide 1691 was amplified utilizing the polymerase chain reaction (PCR) with the forward primer 5'CandCtheAGTGACGTGGAC3' and the reverse primer 5'GACCTAACATGTTCTAGCCAGAAG3'.
The forward primer is labeled with a fluorochrome.
Forward Primer and Reverse Primer sequences were input under the Edit menu and the ΔGs of the most stable overall and 3′-dimer of the Forward Primer, Reverse Primer, and Mixed Oligos were recorded from Analyze > Duplex Formation.
Bacterial 16S rRNA genes were amplified with the universal primers 515F and 909R, and fungal ITSF1 genes were amplified with the forward primer ITSF2_KYO2 and reverse primer ITSF3.
The forward primer was also used for sequencing analysis.
The forward primer was fluorescently labeled with FAM.
The forward primer (5′ 3′) GGAAGTAAAAGTCGTAACAAGG and reverse primer (5′ 3′) GGTCCGTGTTTCAAGACGG were used for DNA amplification.
The forward primer: 5′-AAGATGTCAGCACCAGCTAG-3′ and reverse primer 5′-GTAGGCGTCGGTTATGTAGA-3′.
Sequence of the forward primer and the reverse primers used were as follows: forward primer, 5' AGGCTTTGAGAACCTGTGGA 3'.
