Your English writing platform
Discover LudwigExact(5)
In transactive control, one of the main ideas is to integrate retail and wholesale markets, and other markets, into a single platform, by utilizing forward and spot transactions, thereby guiding investment and operating decisions [32].
The aim of this work is to present a novel sampling-based numerical scheme designed to solve a certain class of stochastic optimal control problems, utilizing forward and backward stochastic differential equations (FBSDEs).
Vorticity, energy and concentration equations are transformed to the form of modified Helmholtz equations by utilizing forward difference with relaxation parameters for the time derivatives, and also approximating Laplacian terms at two consecutive time levels.
Polymerase chain reaction utilizing forward primer 5'andAGCGGCCGCATGAGCGCTTGGCTCCTGCCAGCC3' and reverse primer 5' AAAAGCGGCCGCTCACTTCCCAGTAAACTGGCCTGG3' was used to amplify mGC1 from a plasmid containing an mGC1-eGFP fusion [26].
Nuclear DNA content was analysed, as described (Chew et al., 2005), and data collection was gated utilizing forward light scatter and side light scatter to exclude cell debris and aggregates.
Similar(55)
Binomial regression models predicting depression utilized forward selection model building with total concussion history as the main exposure.
The reactor utilized forward vortex flow, where a preheated simulated syngas containing vaporized naphthalene and toluene tar surrogate was injected tangentially in the flow to ensure effective mixing and reforming of all components.
In this study, a new metabolic pathway for the synthesis of poly[(R -3-hydroxybutyrate] [P(3HB)] was constR -3-hydroxybutyrateant EscheR -3-hydroxybutyratehat utilized forward and reverse reactions catalyzed by two substrate-specific enoyl-CoA hydratases, R-hydratase (PhaJ) and S-hydratase (FadB), to epimerize (S)-3HB-CoA to (R)-3HB-CoA via a crotonyl-CoA intermediate.
The U.S. military also utilizes "Forward Operating Location Kasenyi" in Kampala, Uganda.
Cre amplification utilized forward primer #162 (5'-CGCCGCATAACC andGAAAC-3') and reverse primer #163 (5'-ATGTCCAATTTACTGACCG-3') to amplify a 335 bp fragment.
Sequence verified riboprobe generation templates corresponding to bps 884 1238 of Gapdh (Accession # NM_001001303) and bps 294 705, 792 1185 and 294 1185 of Il7 (Acc # NM_008371) were produced via a PCR based strategy that utilized forward primers flanked by the T3 promoter and reverse primers flanked by the T7 promoter.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com