Sentence examples for utilized in a reverse from inspiring English sources

The property clustering framework is utilized in a reverse problem formulation to achieve a specified set of quality characteristics.

Alternatively, 3D scanning procedures may be utilized in a reverse engineering approach, in which various object iterations or modifications can be made quickly based on scan data without having to develop the base model from the start.

Proportion was utilized in a descriptive analysis.

In GRN analysis, the reverse engineering paradigm is given particular attention, including the various types of models (discrete, continuous, hybrid) which may be utilized in reverse engineering a network's structure.

Spiral-wound membrane (SWM) modules are the most common membrane configuration utilized in reverse osmosis (RO) and nanofiltration.

Sepal and petal tissues utilized in reverse transcription PCR analysis were hand-dissected from ag inflorescences.

Chemical structures of all ligands utilized in reverse docking protocol were generated by CambridgeSoft ChemOffice 2008.

The expression profiles generated by these peanut microarrays will provide starting points for in-depth studies on candidate genes that can be utilized in reverse genetics to assign gene functions.

Heyward-Bey also recorded 208 rushing yards and was often utilized in reverses and other trick plays due to his breakaway speed.

In this study, we have utilized a reverse genetic approach and constructed 59 HK and RR mutants in E. amylovora, which will also provide valuable tools for future global gene expression assays using microarrays to deduce signaling networks in this bacterium.

We designed a forward primer (marked in yellow) in this region and were able to amplify a product utilizing a reverse primer in exon 25 (5′ CAGCGCATCGTCAAAGAGATG3′, spanning intron 24, 255 bp).