Sentence examples similar to utilized and followed from inspiring English sources

Similar(60)

Success rate in the different studies varies considerably from 31.3% to 92.7%; this huge difference is due to the different populations enrolled, different devices utilized, and different follow-up lengths (Tables 4 and 5) [ 4– 47].

Two difference image edge maps, and, are obtained utilizing,, and as follows: (1).

RECIST criteria were utilized and after a median follow up of 14 months, two patients had achieved complete responses and 24 patients had partial responses providing an overall response rate of 51%.

To analyze prox1b involvement in lymphangiogenesis we utilized the fli1 GFP transgenics and followed the formation of the toracic duct (TD), the primary lymph vessel in fish, after prox1b knockdown.

A stronger explanation is needed as to what data was used to construct this figure and how it was utilized; We followed this request and have bolstered our explanation of this analysis in both the Results and discussion and Methods sections.

ProFound Pull-Down Biotinylated Protein Protein Interaction Kit (Pierce, Rockford, IL) was utilized and manufacture's instructions were followed.

Details of the quality assessment included the methodology of randomization, the adequacy of allocation concealment, whether a blind or double-blind method was used, whether an intention-to-treat analysis was utilized and descriptions of withdrawals, and follow-up.

Two DNA primers were designed and utilized as follows: upper strand primer: 5' GTGTTCandGGCCGCTCCGGGCTATGAAATAGAAAAATGAATCCGTTGCCTGCGTTATC3', and lower strand primer: 5'CAGGATGGCGGCCGCCCATCTGGTATCACTTAAAGGTATTAAAAACCCCACAGATGCG3', which were synthesized by Shanghai Sangon Co. Ltd.

To analyze the T cell memory response in ICOS-deficient mice, we utilized MHC class II tetramers and followed the frequency of antigen-specific CD4 T cells over time since primary immunization and then after boosting.

Substrate specificity assays using a mammalian DGAT2 expressed in insect cells showed that oleoyl-CoA was utilized preferentially, followed by palmitoyl-CoA, while activity levels with linoleoyl- and arachidonyl-CoA were similar [ 38].

Thus, panning followed by FACS was utilized, and the strong enrichment of the identified random sample of the library validates this strategy.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: