Sentence examples for utilising primer from inspiring English sources

Genotyping by PCR utilising primer 1: AAACTTACCCACTTGTTTGCC, and primer 2: AGACATCTCAGGTTACTATGGGC detected the presence of the CUL3WT (683 bp) or CUL3Δ403 459 (395 bp) allele.

To obtain about 650 bp of the nuclear 28S rRNA, the D2 and partial D3 region were amplified utilising primers designed by Belshaw and Quicke [ 50] and Mardulyn and Whitfield [ 51].

To increase the specificity of the amplification, we further utilised primers designed for G. desctructans found in France: ITS-F (5'-TCCTCCGCTTATTGATATGC-3') and ITS-R (5'-GGAAGTAAAAGTCGTAACAAGG-3') [12].

To facilitate a separate detection of the FL and AS variants of CA9 mRNA, we utilised primers that allowed for their individual amplification.

Two overlapping amplicons of the pertactin gene were generated from each DNA extract utilising the primer pairs PR8F/PRN1618 and BF/PR5R [ 20].

The DNA encoding the single-chain antibody fragment C595scFv was flanked by PCR with nucleotide sequences containing XbaI and BamHI restriction sites (underlined), respectively, utilising the primer oligonucleotides VH5′, 5′-[GCGGCCCAG TCTAGAATGGCCCAG]-3′ and C595VL3′, 5′-[CGCACCT GGATCCGCCCGTTTCAGCTGCAG]-3′.

Utilising the primer set LHR.ex7.F/ LHR.ex11.R, which straddle the 3′ VDS (Fig. 1b), it was again demonstrated that 'and 'B', 'F', and 'G' splice variant family variants were present in TC cultured over time (Fig. 5b).

Sequencing of VHL Exon 2 utilised the primer CAGGACGGTCTTGATCTCCTG together with VHL Exon 2 (rev).

Utilising these primers clones encoding the human and mouse Sec12 cDNA sequences were obtained by 3' RACE from lung cDNAs.

Additional file 1: GenBank Accession numbers of isolates utilised in primer design, isolate demographic and genotyping data, and sequences with no match at the Neisseria Typing home page.

PCR utilised the primer PoxS2 (5'-cacagtagcaac aagtcggatccgacc-3') and the primer Ext1 (5'-aa ag)(at)(gc)icciccicciccigtita(ct)aa(ag)-3'), where i = inosine) corresponding to the common dicotyledon extensin motif KSPPPPVYK.