Sentence examples for utilised together from inspiring English sources

The solvent velocity at the outlet was found to be relatively high, which was ideal to be utilised together with compact gas liquid separator.

Complementary finite element simulations are presented and utilised, together with the experimental findings, to highlight the main inelastic response characteristics for these forms of connections under direct axial action.

So although they both may be best suited for different outcomes, SEO and PPC can be particularly complimentary when utilised together.

ITrix can be said to be a hypothesis testing application where linguistic types of data (e.g. parts-of-speech patterns) are utilised together with statistically derived data.

To get a detailed understanding of how women who experience an unwanted pregnancy in rural Tanzania make use of traditional providers to interrupt their pregnancy, a combined quantitative and qualitative approach was utilised together with an ethno-pharmacological approach.

It then presents a review of air-path management strategies currently utilised in production, together with the potential of air-path performance management through the use of model based control (MBC).

Simultaneously, and blinded to the quantitative analyses, qualitative analyses would be based on grounded theory [ 63] with both induction and deduction utilised to draw together the empirical data with the theoretical material.

Sequencing of VHL Exon 2 utilised the primer CAGGACGGTCTTGATCTCCTG together with VHL Exon 2 (rev).

Several care bundle studies have suggested that utilising various strategies together (such as training, regular lines monitoring and using dedicated line insertion trolleys) can have a positive impact on CRBSI rates [ 3- 6].

Nevertheless, appearance models are not useful in case of noisy data, bad contrast or objects too far in the scene, but the general object model utilised in the proposed approach, together with a proper management of possible hypotheses, allows to better respond to these situations.

For this purpose, we utilised the probabilistic approach VBQTL together with R/eqtl to account for hidden confounding factors [ 24].