Sentence examples for utilised separately from inspiring English sources

In particular, the capabilities of the optical and mechanical axes were investigated when they were utilised separately or in combination for precision laser machining.

In order to maximize usable returned sequence data, a combination of three primers were utilised separately for each clone: C.elegans RNAi F from the Source BioScience library, forward 5′ ggagaccggcagatctgata, and reverse 5′ ggcctcttcgctattacgc.

The two different techniques of nitrogen sorption and mercury porosimetry, which are generally utilised completely separately, have been integrated into the same experiment to improve upon the information obtained from both methods.

Using attendance data, linear regression analysis was utilised to separately identify individual and home-level factors predictive of attendance at exercise in the residential and nursing homes.

Furthermore, to ensure that for each test gene analysed the sequences amplified were reflective of processed and full-length messenger RNA, two sets of primers were utilised (in separate PCR reactions), designed to amplify sequences towards the 5′ and separately, the 3′ regions of each gene.

Exploratory factor analyses were performed for HSCL-10 and PADQ separately, utilising a principal axis factor extraction and Promax rotation to examine the underlying factor structure.

The remaining panicles were collected separately from each plant and utilised for calculating yield potential of RILs under heat stress.

Neurite outgrowth studies, which were conducted separately from the biochemical studies, utilised PC12 cells (grown in DMEM+10% fetal bovine serum) treated with NGF at 50 ng/ml in serum-free DMEM for 48 h.

The method of using a model fitted separately for each admission diagnosis is utilised in mortality indicators employed internationally.

For studies that utilised serology, data on HPV prevalence were extracted separately by serological marker (i.e., L1 vs E6/E7).

Outcomes from each data collection phase will be disseminated separately if analysis warrants it; all data collection will be utilised in the realist evaluation.