Sentence examples for utilised for expression from inspiring English sources

P psbA2 is a native Synechocystis PCC6803 light inducible promoter regularly utilised for expression of genes in Synechocystis PCC 6803 [ 22].

Indeed, activation of an alternative expression site has already been described in B. hermsii[ 23], utilised for expression of the vector transmission associated protein Vtp33 [ 24].

The SbSOS1-specific primer pair RT F (5′-GGAAGGTTTGGGGATGGTAT-3′) and RT R (5′-GTCCAGCAAGCAAAACCATT-3′) were utilised for expression study of SbSOS1, whereas QBT F (5′-GGAGTCACCGAG GCAGAG-3′) and QBT R (5′-ATCACATATCAGAAACCACAA-3′) primers were used for an internal control.

The SbSOS1-specific primer pair, RT F (5′-GGAAGGTTTGGGGATGGTAT-3′) and RT R (5′-GTCCAGCAAGCAAACCATT-3′), was utilised for expression study of the SbSOS1, whereas QACT F (5′-CGTTTGGATCTTGCTGGTCGT-3′) and QACT R (5′- CAGCAATGCCAGGGAACATAG −3′) primers were used for actin.

This is likely because the turnover of β-Syn mRNA is quite rapid and the protein synthesis machinery is unable to compete, but in the presence of MTF-1 the rate of mRNA synthesis is greater which leads to significant amounts of mRNA being utilised for protein expression.

P. pastoris X-33 (Invitrogen) was utilised for gene expression.

To study the role of microRNA (miRNA) in the regulation of Chinese hamster ovary (CHO) cell growth, qPCR, microarray and quantitative LC-MS/MS analysis were utilised for simultaneous expression profiling of miRNA, mRNA and protein.

The SOCS3 –4874 AA genotype was strongly associated with antiviral treatment failure, and AA genotype carriers had significantly higher SOCS3 mRNA and protein levels The diversity of microarray platforms utilised for gene expression analysis and the variability in microarray data emphasise the need for quality assurance.

This is prerequisite for many statistical methods, like for example linear model fitting and moderate t-statistics [ 21], that are utilised for analysing gene expression data.

The relative fluorescence levels were extensively examined to determine if pCA2.4 could be utilised to express high levels of desired genes under long-term culturing conditions.> > The objective of this work was to determine if pCA2.4 could be utilised for stable high-level expression of genes of interest in Synechocystis PCC6803.

MacBlue transgenic mice can also be utilised for macrophage-specific over-expression of UAS-containing GAL4-dependent transgenes [24].