Sentence examples for utilised as control from inspiring English sources

Glutathione inhibition by BSO was utilised as control.

A locus-specific probe was used for detecting CDKN2A/p16INK4a, CDKN2A/p14ARF and CDKN2B/p15INK4b loss (P1 clone 1063, A Kamb, Myriad Genetics) and the chromosome 9 centromeric probe (CEP9 Vysis) was utilised as control.

Descriptive statistics were utilised as appropriate.

In vitro cell proliferation and cell morphology studies using MG-63 osteoblastic cells were carried out on the HA coated substrates obtained using the two deposition techniques, with untreated titanium grade 5 (Ti–6Al–4V) substrates utilised as a control.

Three inlA probe-modified electrodes were utilised as a control (inlA probe) for each experiment.

Noteworthy, the molecular weight of NY-ESO-1 expressed by 5-AZA-CdR-treated MPP-89 and MES-CM98 MM cells was identical to that of NY-ESO-1 constitutively expressed by HT1080 fibrosarcoma cells utilised as positive control.

The R4-cyto construct expressing an anti-β-gal scFv targeted to the cytoplasm, utilised as a control of stable and soluble scFv antibody, was kindly provided by A. Cattaneo.

Total RNA (1  μg) was reverse transcribed and the resulting cDNA was amplified using specific primer sets for TGF- α (5′ CCACACTCAGTTCTGCTTCC and 3′ TCTTTATTGATCTGCCACAGTC), insulin (5′ TCACACCTGGTGGAAGCTC and 3′ ACAATGCCACGCTTCTGC) and IGF-II (5′ TGGGAATCCCAATGGGGAAG and 3′ CTTGCCCACGGGGTATCT). Pancreatic cDNA (BD Biosciences, Erembodegem, Belgium) was utilised as a control for insulin.

Invasive breast cancer specimens were utilised as positive controls.

β-Actin primers were utilised as positive controls.

The vectors pHIV-1SDmSneoLTR (a vector containing unmodified and intact 5' and 3' LTRs), and pHIV-1SDmSneo were utilised as assay controls.