Sentence examples for utilised as a control from inspiring English sources
In vitro cell proliferation and cell morphology studies using MG-63 osteoblastic cells were carried out on the HA coated substrates obtained using the two deposition techniques, with untreated titanium grade 5 (Ti–6Al–4V) substrates utilised as a control.
Three inlA probe-modified electrodes were utilised as a control (inlA probe) for each experiment.
The R4-cyto construct expressing an anti-β-gal scFv targeted to the cytoplasm, utilised as a control of stable and soluble scFv antibody, was kindly provided by A. Cattaneo.
Total RNA (1 μg) was reverse transcribed and the resulting cDNA was amplified using specific primer sets for TGF- α (5′ CCACACTCAGTTCTGCTTCC and 3′ TCTTTATTGATCTGCCACAGTC), insulin (5′ TCACACCTGGTGGAAGCTC and 3′ ACAATGCCACGCTTCTGC) and IGF-II (5′ TGGGAATCCCAATGGGGAAG and 3′ CTTGCCCACGGGGTATCT). Pancreatic cDNA (BD Biosciences, Erembodegem, Belgium) was utilised as a control for insulin.
The yeast Metschnikowia pulcherrima, previously utilised as a biological control agent, was evaluated for its potential to produce lipids for biofuel production.
The cytotoxic and apoptotic effects of paclitaxel have been utilised as a positive control in a study done by Moongkarndi et al. [ 34] in Ovarian and breast cancer cell lines.
They were selected from a group of individuals who had undergone SPECT with the intention that they would be utilised as a normal control group for SPECT analyses [ 23].
A commercially available centromeric probe for chromosome2 CEP2 (Abbott Molecular, Des Plaines, IL, USA) was utilised as an internal control.
It is possible, however, that such scenarios could potentially be utilised as a tightly matched control for an CBM-I task where the same emotional information is presented as an active training condition, but in a manner that does not serve to modify the critical interpretive bias targeted in the training condition.
In this paper, a flexible plate structure is utilised as a platform to assess the performance of an active vibration control (AVC) mechanism developed in this work based on a real coded genetic algorithm.
Through the application of iterative quality improvement systems, such as statistical process control (SPC), the depicted learning curves could be utilised as a baseline against which to chart the progress of surgical personnel whether to meet administrative or educational goals.
