Your English writing platform
Discover LudwigSuggestions(2)
Exact(40)
To obtain the puf-A complete cDNA, rapid amplification of 5'- and 3'-cDNA ends (5'-RACE and 3'-RACE) was performed with total RNA of the ovaries using the SMART cDNA amplification kit (Clontech Laboratories, Palo Alto, CA, USA).
First strand cDNA synthesis by reverse transcription of isolated polyadenylated RNA and amplification of cDNA was performed using the SMART cDNA library construction kit according to the protocol recommendations.
The cDNA library was constructed as described [18] using the SMART cDNA Library Construction Kit (Clontech, Mountain View, USA) and 5'/3' RACE was performed using the adapter primers in combination with primers designed against cmFP512 (5' gcagtgatatcacatataaagacaaagttctgcatgg 3').
Single-stranded cDNA was prepared from mRNA using the SMART cDNA Synthesis kit (Clontech).
This mRNA was reverse transcribed into double-stranded cDNA using the SMART cDNA synthesis Kit.
Double-stranded cDNA was synthesized using the SMART cDNA library construction kit (Clontech, USA).
Similar(20)
The RNA was used to make first strand cDNA using the SMART RACE cDNA amplification system, whereby two sets of first strand cDNA are created, 3 and 5 primed cDNA.
Two micrograms of RNA was used as template for first strand cDNA synthesis to make 3'RACE-ready cDNA using The SMART RACE cDNA Amplification Kit according to the manufacturer's protocol (Clonetech).
The original partial clone 5144 [16] contains 1.6 kb, and was extended to 1.9 kb full-length mych cDNA using the SMART RACE cDNA Amplification Kit (ClonTech).
The total RNA was reverse-transcribed to cDNA using the SMART RACE cDNA Amplification Kit (Clontech) and SuperScript III Reverse Transcriptase (Invitrogen).
One microgram of poly(A)+ RNA was used to synthesize double-stranded cDNA using the Smart PCR cDNA synthesis Kit (Clontech Laboratories) according to the protocol supplied by the manufacturer.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com