Sentence examples similar to using the same grass roots from inspiring English sources

These same two species accounted for 58% of isolates in culture-based analysis of the same grass root tissue.

" 'Uganda happens to have a Unique Community Organisation system where the grass-root Unit is the Resistance Council comprising a village or two depending on the population density, For purposes of Community based health care, we have adopted the same grass root unit to divide the population into the various communities.

The well-financed Mr. Abbott is popular with the same grass-roots conservatives who have propelled Mr. Perry to one statewide victory after another since 1990.

The intention, of course, is to develop pitches using the same soil type and grass rooting, with the aim of obtaining similar pace and bounce, although this raises the question as to why it cannot, therefore, be done elsewhere.

For roots with RFLP patterns which did not match any database taxa, the nuclear ribosomal ITS region was amplified using the same PCR protocol as for the trnL intron but with primers ITS4 [ 9], and ITS1P (AACCTTATCATTTAGAGGAAGG), newly designed to preferentially amplify grasses but not fungi.

That's because these institutions use the same methods, have the same roots and are funded by the same people.

That's because these institutions use the same methods, have the same roots, and are funded by the same people.

We used the same model to compare the above-ground biomass of the grass grown with the three plant classes.

(The Supreme Court's terrifying Citizens United ruling could use a grass roots remedy).

He believes that using Bittorent is a very logical way to achieve the goal of using grass roots online volunteers to distribute information.

At the same time, whatever grass roots snooker has are being aggressively theme-pubbed over as the late-night halls and snooker clubs close down.