Sentence examples for using the same genomic from inspiring English sources

After confirming the amount and integrity of the PCR products by agarose gel electrophoresis, we mixed virtually equal amounts of the respective PCR amplicons that were generated using the same genomic DNA and applied the samples to a 454 Genome Sequencer (GS -FLX system (Roche DiaGS -FLXsystem., USA).

The candidate GVs were PCR amplified using the same genomic DNA library prepared from the CB4856 strain that was sent for whole-genome sequencing.

All reactions were performed in triplicates using the same genomic DNA stock.

All reactions were performed in quadruplicates using the same genomic DNA stock.

Gene-specific primers Ba_TPI_207U (TTCGGCTGAGATGATAAAGG) and Ba_TPI_473L (AGTACCAATGGCCCACACTG) were designed within the Tpi sequence to amplify an intronic region, using the same genomic template as for the AFLP reactions.

Having excluded a pathogenic mtDNA mutation, we subjected the samples to WES to investigate a suspected Mendelian mitochondrial disorder, using the same genomic DNA sample.

Colombian strains have only 306 nucleotides of E/NS1 junction sequenced [8]; therefore, we used the same genomic region to analyze the phylogenetic relationship of the DENV-3.

We used the same genomic PCR strategy as described above to clone and sequence 10,423 bp of p2[P1-rr4B2] p2[P1-rr4B2]454272].

Importantly, genomic maps of ER binding induced with estrogen or tamoxifen are almost identical (Hurtado et al. 2011), which evidences that tamoxifen ER uses the same genomic regions as estrogen ER for its repressive action.

To perform oaCGH analysis, we used the same genomic DNA from the mdf-1 such-4; dog-1 lines (F170, F270 and F470) that were used for the WGS and the reference N2 DNA that was prepared following a standard protocol.

SynapDx uses the same genome sequencers from companies like Illumina that many other genomic data startups are using.