Sentence examples for using the program design from inspiring English sources

The experimental matrix and detailed work sheet to make 148 solutions having random but balanced combination of these levels were calculated using the program DESIGN.

The gene specific probes (oligonucleotide of 35-40-mer 35-40-mer 35-40-mered in quadrandomlye across the array, were distributeding the program design OligoArray 2.1 [ 53].

Design: The CP was designed by using the program Proton (Clinical Computing Clinical Information Systems, Middlesex, England).

Specific primers were designed using the program Primer Express Applied Biosystemss) for the following targets: TGF-β1 F: ATG TCA CTG GAG TCG TGA GGC.

Bisulfite modified DNA was amplified with primers designed using the program MethPrimer [19], forward primer: 5'-TTGGTTAGTAATAATGATTTTATTTTTAGA -3' and reverse primer 5'- CTAACTCTCAAAACCACCTTTCTCT -3'.

DNA sequences were visually inspected to identify perfect and compound microsatellite sequences and PCR primers specific to each locus designed using the program fastpcr [43].

Information in the returned questionnaires was entered into an interface designed using the program CSPro 4.0.

Oligonucleotide probes (60-mer) were designed using the program CADO4MI [ 24].

Primers were designed using the program Primer3 (Koressaar and Remm 2007; Untergasser et al. 2012).

One primer pair for each gene was designed using the program PrimerSelect (DNASTAR, Wilmington, DE, USA).

Taqman assays were designed using the program PrimerExpress v 2.0 (Applied Biosystems) with default parameters.