Your English writing platform
Free sign upSuggestions(1)
Exact(3)
b, Southern blot analysis of genomic DNA from parental (P) Dcx+/Y (wild-type) ES cell line and Dcx−/Y ES-cell clones 7F and 8E, using the probes and digests depicted in a.
FISH was performed at 46 °C for 2 h (Manz et al. 1992) using the probes and hybridization conditions shown in Table 2.
cDNA was diluted to 100 ng/μL for subsequent TaqMan quantitative PCR analysis (ABI 7500) using the probes and primers listed in Table 2.
Similar(57)
The AV-8B can also receive additional fuel via aerial refueling using the probe-and-drogue system.
The summer had been so warm that almost everywhere the active layer had grown deeper, in some spots by just a few centimetres, in other spots by more than that; in places where the active layer was particularly deep, Romanovsky had had to work out a new way of measuring it using the probe and a wooden ruler.
Around 1954, NATC modified the sole surviving XAJ-1 to conduct inflight refueling tests using the probe and drogue configuration.
All 18 clones gave a 255 bp PCR product using the probe and an AFP specific primer (Table 1).
To enable a direct comparison between microarray and sequencing data, both data sets were coupled by using the probe and sequence data.
The expression levels were analysed using the probes ILMN_1706612 and ILMN_1799120 for WFDC2 and ILMN_1736316 for MUC16.
Determination of 16S rRNA gene copy numbers was performed using the probes 5' TGATGAAGGCCTTAGGGTTG 3' and 5' TAAACCGCCTACGCACTCTT 3' on the LightCycler system together with the SYBR Green master mix (Roche).
The intracellular levels of H2O2 and O2− were detected using the probes DCFH-DA and HEt, respectively.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com