Sentence examples for using the primer sequence from inspiring English sources

The real-time (RT -qPCR was caRT -qPCRt using the primer sequence reported in Table 1.

The 578 bp Rmst cDNA used as the probe template was amplified using the primer sequence GCCCTTCTAGTTGGTGGCCTTGTC and CTCCTGAGTGTTAGTGCTGCCTG, and cloned into pCR-II TOPO vector (Invitrogen), whilst the Lmx1a probe was a kind gift of Dr. J Ericson.

The LEF-1 250/255 mutation was created using the primer sequence 5'-catatgattcccggtgtagcgctagcactagcaactggcatccctcat-3'.

The LEF-1 GBS (mutation of AA 241 248) was created using the primer sequence 5'-acttccatgtccggggtagcgctagcactagcagccggtcctcctggtccc-3'.

For PCR analysis, 0.5  μg cDNA was used as a template and amplified using the primer sequence shown in Supplementary Information, Supplementary Table S1.

For PCR analysis, 0.5  μg of cDNA was used as a template and amplified using the primer sequence shown in Supplementary Table S1.

All assays were performed in duplicate using the primer sequences in Table S5.

The protein-coding region was amplified using the primer sequences shown in Figure 1B and sequenced (NCBI accession No. HQ112291).

The PCR products were amplified using the primer sequences for WRKY70: F (5'-agcaactcctctctcaacccg-3'); R: (5'-ccattgacgtaactggcctga-3'); ACTIN7: F (5'-ggtgaggatattcagccacttgtctg-3'); R: (5'-tgtgagatcccgacccgcaagatc-3').

PCR was then carried out using the primer sequences and conditions listed in Table 1.

PCR amplicons for all target sequences were produced by monoplex conventional PCR using the primer sequences outlined below.