Your English writing platform
Discover LudwigSuggestions(5)
"using the previously used" is correct and can be used in written English
It is typically used to refer back to something that was previously mentioned or used. Here is an example: "The scientists conducted their research using the previously used methods, but they also introduced a new approach to their study."
Exact(4)
Also, the categorization of data is not uniform among cities, as the published data already existed and continues to be made available using the previously used, proprietary formats.
By controlling the water content and using the previously used electrolyte, nanotube arrays with surface morphology, geometrical parameters and adhesion properties relevant to required applications can be achieved.
Aliquots of both PCR products were then mixed and amplified using the previously used 5' primer for the OmpA fragment and the 3' primer for boophilin.
We also explored the relative prognostic power of existing CMML clinical models compared with those with ASXL1 mutation using the previously used ROC and C-index approach.
Similar(56)
Before each step the user is given the choice to change parameters or use the previously used (or standard) parameters.
Since the PLMN phenotype was not classified in the revised El Escorial criteria, we used the previously used term of "suspected ALS" elaborated in the primary El Escorial criteria.
While it will be available on smartphones, the feature is primarily aimed at larger devices including phablets and tablets such as Google's Pixel C. Users will be able to double-tap the recently used apps button to switch to the previously used app without opening the recently used apps list, speeding up bouncing between apps.
Because of the gapless design, the previously used screw mechanism used to induce preload was not necessary.
In the simplified method, this process is improved by employing pure water without the use of additives like the previously used ammonia or hydrogen peroxide.
Interestingly, inappropriate bed use at the previously used overflow units, such as the PACU, also decreased.
The previously used C7orf28B was used as a reference gene (F: 5′-3′ CandACAGGTTGACCAAGGA and R: 5′-3′ TTGTGCAGGATCAGAGCATC) [ 29].
More suggestions(2)
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com