Sentence examples for using the previously constructed from inspiring English sources
The oleT JE gene was amplified using the previously constructed plasmid pET-28(b)- oleT JE as template and the primer pair as follows: BamHI- oleT JE, CGC GGATCCGATGGCAACACTTAAGAGGGATAAGGGCTTA (the BamHI restriction site is italicized); and HindIII- oleT JE, CAATG AAGCTTTTATGTTCTGTCTAC AACTTCGC (the italicized nucleotides denote the HindIII cutting site).
We use the previously constructed cost matrix to find the optimum match between the objects in each non-empty page.
Complementation of this strain was performed using the previously described construct, pBSV2G p66 (Ristow et al., 2012).
An S. gordonii strain secreting human IL-1ra into the culture medium was constructed using the previously described host-vector system [ 31].
The artificial resveratrol and methylated resveratrol biosynthetic plasmids were constructed using the previously described cloning methods [ 18], and each plasmid contained genes with their own T7 promoter, ribosome-binding site (RBS), and terminator sequence as in the parental vectors.
These HMMs were constructed using the previously identified TF families in E. coli K-12 and B. subtilis as seeds, considering the DNA-binding domain (DBD) sequence (around 60 amino acids) of every protein from multiple families.
Third, using a previously constructed design file, relationships between the raw data for each sample and the sample groups were established.
To analyze the distribution of laccase genes in the L. edodes genome, localization was carried out using a previously constructed linkage map of L. edodes (Miyazaki et al. 2008).
The absorbance was converted for a final concentration of benzene using a previously constructed calibration curve.
To examine the role of the NiV accessory proteins, we constructed the recombinant infectious clones, namely pNiV(V−), pNiV(W−) and pNiV(C−), that do not express mRNA of each accessory protein, using our previously constructed full-length NiV cDNA [8].
Using our previously constructed, carotenoid-engineered cell models in citrus [ 28], we examined carotenoid-related biological processes.
